October 2007 | Home
U-M Heritage
North Quad and Nellie's Books
U-M's newest dorm will stand on one of Ann Arbor's most historic sites.
Plus: Help us tell U-M's history by sharing your story here.
Most emailed stories
- Exactly how much housework does a husband create?
- The Doors' disaster at Michigan
- U-M Heritage: Panty Raid, 1952
Faculty at work
What really affects poverty?
Talking about movies
The camera as storyteller
Talking about words
What's the point?
Pity the poor apostrophe. Could it be following the lead of the "long ess"?
Talking about science
Barrel of Monkeys
Arthur Thurnau Professor of Chemistry
Slideshow: How do some anti-viral drugs interrupt a virus's DNA chain?
For thousands of years, discovering medical drugs was a matter of brute force. If enough people with enough ailments chewed on enough roots for enough time, good and bad trends were observed. Over 2500 years ago, people learned that chewing on the leaves of the Salix or “weeping” willow tree, for example, relieved headaches and reduced inflammation of swollen joints. In the late 1800s, German chemists isolated a compound they called “salicin” from the willow (the rest was just, well, chewing on leaves and wood). When treated with acid, as in the human stomach, the salicin became salicylic acid. Not long after, German chemists set up a manufacturing company (called Bayer) that could produce tons of a salicylic acid derivative called acetyl salicylate (easier on the stomach), and which they chose to name “aspirin,” after the Spiraea flower, where salicylic acid was observed to occur naturally.
Our knowledge of the underlying chemistry of biological processes increased dramatically during the twentieth century, and we began to map, molecule-by-molecule, where the substances in our bodies come from, where they go, and how they function. This knowledge has revolutionized—sort of—the way we discover new drugs.
One of the most significant discoveries was the structure of the molecules that make up our genetic code (DNA and RNA), and the process by which living cells grow and duplicate their genetic material.
Molecular strands of DNA are deceptively simple. Like a 4-color pearl necklace, a molecular strand of DNA is made up of long sequences of only 4 other smaller molecules (call them A, T, C, and G) that are chemically joined together. Every cell in the body contains its own DNA, and the pattern of how those DNA molecules are connected "tells" the cell what it is and what it does. For example, the sequence
TCACCCAGGCTGGAGTGCAG
TGACATGATCTCAGCTCACT
GCAGTCTCTGCCTCCTGGGT
TCCAGCAATTCTTCTGCCTC
AGCCTCCCAGGTAGCTGGGA
TTACAAGCATGTACCATTAC
is how your body codes the prime instructions for making the molecule named insulin. And when your pancreas cells—where insulin molecules are built—reproduce themselves during the normal course of growth, your body gathers together the 4 building blocks (A/T/C/G) and uses its molecular machinery for growing DNA chains to assemble this particular sequence of molecules and make a duplicate copy for the new cell. Once copied, the new cell carries the proper instructions for making insulin molecules, too.
I said that these strings of molecules are like pearls on a necklace, but that metaphor is not quite right. Individual pearls are not physically connected to one another, as DNA molecules are. A better way to think of how DNA molecules are built is to think of the children’s game Barrel of Monkeys. Each monkey has two hooked arms, and every time you hook one of the arms and lift, the new monkey at the end has a second hooked arm for picking up the next monkey, and so forth. Each of the 4 small molecules (A, T, C and G) has two chemical "arms" that hook them together. This happens quite rapidly in your cells, but as in the children’s game, it happens one monkey at a time.
Here's where drug discovery comes in.
While every living organism on our planet uses DNA molecules to hold its genetic code, one type of entity does not have the machinery to build its own DNA chains: viruses. Consequently, in order to survive, a virus is a type of organism that needs to infect a host (such as you) and then gets your cells to do the work that it cannot do by itself.
A virus literally inserts its DNA into a host cell, and "hijacks" its host’s DNA growth machinery. The virus’s DNA is made up of the same 4 molecules (A, T, C, and G) as your own DNA, and your cells cannot tell the difference between your own DNA and that of a virus. So when your cell grows—copying your DNA as it does so—you are also making copies of the virus’s DNA. Here’s the problem: every copy of the virus’s DNA eventually results in a new copy of the virus itself.
So your own molecular machinery is responsible for copying and spreading the virus that infects you.
By the mid-twentieth century, our better understanding of molecular processes gave medical scientists and chemists new ways of thinking about anti-viral drugs: could we invent a way to stop the growth of a virus’s DNA chain without interfering with the growth of our own chains? You cannot interfere with the machinery that does the copying, because then your own cells would not be able to reproduce—and that would be fatal. One of the most obvious strategies, then, was to go after the 4 building block monkeys (the A/T/C/G molecules), and in particular, to invent a one-armed monkey. Because it takes a monkey with two arms to continue the growth of a chain, if your DNA-growing machinery could slip a one-armed monkey into the virus’s monkey chain, it would stop its growth. There would be no “chemical arm” to grab the next monkey. The challenge would be to prevent your machinery from inserting the one-armed monkey into your own chains, which would be fatal for your own cells. A one-armed monkey, therefore, represented a possible strategy for creating an anti-viral drug.
Though this approach is advanced science, the search for new drugs still remains a bit like chewing on every plant you see. In the late 1950s and early 1960s, hundreds of different molecules of the “one-armed monkey” variety were prepared and tested as possible drug candidates. Some of these had no effect at all; perhaps they could not even make their way into cells. Some of them killed the host’s cells faster than the virus, and some of them did exactly what they were supposed to do—killing the virus and basically leaving the host alone. The reason why one of these one-armed monkeys gets preferentially incorporated into the virus and not the host, and others do not, is a mystery that many people would like to understand more completely; but for now, drug discovery still advances primarily by trial and error.
A few of these one-armed monkeys are familiar. For example, acyclovir is a one-armed monkey that is effective for treating the herpes virus. When patients rub an ointment that contains acyclovir on their herpes outbreaks, some of it makes its way into their cells. As the infected cells churn out copies of both the patient’s DNA and the herpes’ DNA, the acyclovir gets preferentially incorporated into the copy of the herpes DNA. Every time that happens, no new herpes virus is formed from that incomplete DNA; the drug molecule has had its desired effect.
In the early 1980s, when it was discovered that AIDS was caused by a virus, scientists once again pulled out the one-armed monkeys to see if they could do the job. Even the drug candidates that failed in the 1960s were tried again in order to see if anything could stop this virulent disease. Interestingly enough, one of the one-armed monkeys from twenty-five years earlier turned out to be effective. This molecule is azidothymidine, a one-armed “T” monkey, also known at AZT.
Not every anti-viral treatment is based on the one-armed monkey strategy, but it has turned out to be an effective option. Researchers continue to seek molecules that can fool viruses and other disease organisms into grabbing hold of them and then interfere with their growth. This intentional, molecular way of thinking about drug design has added an important alternative to chewing on bark to see if anything interesting happens.
Brian P. Coppola is an Arthur F. Thurnau Professor and Professor of Chemistry at the University of Michigan. He currently directs a program in which undergraduate, graduate and post-doctoral students in chemistry, who are thinking about academic careers, can add education studies to their training.



